
Journal of Biotechnology
E-ISSN: 2814-1040
Volume 2, No. 1, 2023
Pages 22-33
DOI: 10.36108/jbt/3202.20.0120
Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria
NYAKU, Elisha Raymond, DIYAWARE, Mohammed Yakubu 2, SULEIMAN, Sa’adu Bala 2 and NWAFILI, Sylvanus Anene3
1National Institute for Freshwater Fisheries Research (NIFFR), Maiduguri Zonal Office, Nigeria
2Department of Fisheries, Faculty of Agriculture, University of Maiduguri, Nigeria.
3Department of Animal Science and Fisheries, Faculty of Agriculture, University of Port Harcourt, Nigeria
*Corresponding author: Email:saadbala@unimaid.edu.ng Orcid: https://orcid.org/0000-0003-2560-3345
Abstract
This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation.
Keywords: Genetic Diversity, Lake Alau, Lake Bako, Mitochondrial DNA, Oreochromis niloticus
